COMT Val158Met Polymorphism and Executive Functions in Obsessive-Compulsive Disorder
Publication: The Journal of Neuropsychiatry and Clinical Neurosciences
Abstract
This study investigated the association between the catechol-O-methyl transferase (COMT) Val158Met polymorphism and executive functions in 101 patients with obsessive-compulsive disorder (OCD) and 100 healthy-control subjects (HS). Results showed that there was no significant difference for the genotype distributions between the OCD and HS groups. OCD-Met carrier subgroup's TMT B-A difference and lexical fluency scores were found to be significantly poorer than both HS subgroups. These findings suggest that lower activity of COMT associated with the Met allele, leading to higher levels of dopamine in the prefrontal cortex, lead to poorer executive function in OCD.
Catechol-O-methyl transferase (COMT) is an enzyme that plays an important role in the regulation of the dopaminergic neurotransmitter system by catabolizing dopamine (DA).1–3 A functional polymorphism in the coding sequence of the COMT gene (rs4680), consisting of a G-to-A transition at codon 158 resulting in a valine (Val) to methionine (Met) amino acid substitution (Val158Met) affects DA regulation in the central nervous system, particularly in prefrontal cortex and reduces the activity of the enzyme to one-quarter of what is encoded by the Val allele.4 Thereby, this lower activity of the enzyme due to this substitution leads to higher levels of DA in the prefrontal cortex.5,6 Since higher DA levels are implicated in pathogenesis of OCD, the polymorphism of COMT may be a candidate for a susceptibility marker for OCD.
Studies suggest that COMT allelic variants might have an effect on various cognitive domains, such as memory, executive functions, and decision-making.7 However, the relationship between the COMT Val158Met polymorphism and prefrontally-mediated executive functioning/decision-making have been somewhat controversial. Better performance on executive functioning tests of frontal function was associated with the low-activity Met allele in a number of studies,8–11 whereas others showed a trend12,13 or found no evidence for an association.14,15 On the other hand, it has been shown that subjects homozygous for the Met for Val158Met or C for the rs4818 C/G synonymous polymorphisms with low COMT activity and high DA levels exhibited poorer performance on the Iowa Gambling Task (IGT), a task of emotionally-informed decision-making that is attributed to ventromedial prefrontal functioning, than subjects homozygous for the Val or G allele with high COMT activity and low DA levels.16,17
It has been assumed that the association of the Met158 allele with OCD reflects the lower enzyme activity of Met-COMT and the consequent enhancement of cortical dopamine signaling, relative to Val-COMT.18 We hypothesized that lower activity of the COMT associated with the Met allele leading to higher levels of DA in the prefrontal cortex may enhance the executive deficits in OCD patients.
The objective of this study was 1) to assess the genetic association of COMT Val158Met polymorphism with OCD; 2) to investigate whether the COMT Val158Met polymorphism is associated with the other characteristics of patients with OCD, such as sex, age at onset, duration of illness, and severity of obsessions and compulsions; 3) to evaluate the association of the COMT Val158Met polymorphism with executive functions in OCD.
Methods
Subjects
A total of 101 consecutive unmedicated patients with OCD, who fulfilled DSM-IV19 diagnostic criteria, were seen in the Anxiety Disorders Outpatient Clinic of the Psychiatry Department of Istanbul Faculty of Medicine between January 2005 and September 2009, and were included in this study; 100 healthy-control subjects, who were screened for the absence of psychiatric disorder as well as any family history of psychiatric disorder, were recruited on a voluntary basis and were matched to the patients for age and sex.
The Ethics Committee of Istanbul University Istanbul Faculty of Medicine approved the study. Written informed consent was obtained from all of the patients after the procedures had been fully explained. This study adheres to the Declaration of Helsinki.
Inclusion criteria were 1) OCD diagnosed with the Structured Clinical Interview for DSM-IV/Clinical Version (SCID-I/CV);20 2) the Yale-Brown Obsessive-Compulsive Scale (Y-BOCS)21,22 scores ≥16; 3) ages between 17 and 50 years; 4) being medication-free for at least 6 weeks. Exclusion criteria were 1) any current psychiatric disorder other than OCD diagnosed with the SCID-I/CV; 2) history of alcohol or drug abuse/dependence; 3) any serious concomitant general medical condition or neurological disease; 4) history of medical disorders that may have a causal relationship with OCD; 5) pregnancy or lactation.
Among our patients, 41 (40.6%) were treatment-naïve, with none having previously received any pharmacotherapy; 60 patients (59.4%) had taken different types of SSRIs, with different dosages, before the 6-week drug-free period.
Clinical Assessment
Diagnosis was made during the initial interview by trained psychiatrists. The Y-BOCS and the Hamilton Rating Scale for Depression (Ham-D)23 were administered to the patients during the second interview. A semistructured interview form prepared by the authors was used to evaluate the demographic features of the subjects.
Genotyping
The genomic DNA fragment containing the Val158Met polymorphism in the human COMT sequence (GenBank Accession no. AY341246, with the SNP site being in nucleotide 23 753 of this accession number) was amplified by the PCR method. The polymorphism was evaluated using two primer pairs in the same PCR, as described by Ruiz-Sanz et al.24 A 626 bp band was always obtained as control for the success of the amplification, using the P1 and P2 primers pair in Table 1. On the basis of the nucleotide substitution at position 21 881 on the COMT gene, two primers, P3 and P4, with complementary 3′-terminal nucleotide to the corresponding polymorphism, were introduced (Table 1).
| Primer | Sequence (5′–3′) | 5′-end nt position | 3′-end nt position |
|---|---|---|---|
| P1 (forward) | CCAACCCTGCACAGGCAAGAT | –14 exon 4 | +7 exon 4 |
| P2 (reverse) | CAAGGGTGACCTGGAACAGCG | +10 exon 5 | –11 exon 5 |
| P3 (forward) | CGGATGGTGGATTTCGCTGaCG | +162 exon 4 | +183 exon 4 |
| P4 (reverse) | TCAGGCATGCACACCTTGTCCTTtAT | –395 exon 5 | +183 exon 4 |
The 3′-end of the allele-specific primers is underlined. Underlined lowercase bases indicate the introduced mismatches; COMT: catechol-O-methyltransferase.
The PCR reaction was carried out in a total volume of 25 μL, containing 30 ng of genomic DNA as template, 0.5 μM of each primer, 100 μM of each dNTP, 1.25 mM of MgCl2, Taq buffer (20 mM Tris-HCl pH 8.4, 50 mM KCl), 5% DMSO, and 1 U Taq DNA polymerase (Bioline, U.S.A., Inc.). PCR amplification was carried out in a TGradient thermo-cycler (Wathman-Biometra, Göttingen, Germany) with an initial denaturation at 94°C for 4 min., followed by 30 cycles of 94°C for 30 sec., 62°C for 30 sec, and 72°C for 20 sec., and a final extension at 72°C for 5 min. An 8 μL aliquot of the PCR products was mixed with 2 μL of loading buffer and subjected to agarose gel (1.5%) electrophoresis stained with ethidium bromide. This procedure rendered 3 bands in heterozygotes (626, 451, and 222 bp) and 2 bands in homozygotes (Met158/Met158, resulting in 626 and 222 bp, and Val158/Val158, resulting in 626 and 451 bp).
Neuropsychological Assessment
A comprehensive neuropsychological battery was administered in a separate session. The followings are the specific neuropsychological tests that comprised the battery:
The Wisconsin Card-Sorting Test (WCST)25 is a test in which the subject is required to sort the deck of cards under the reference cards according to pre-specified rules unbeknownst to her, and, furthermore, she is unaware that the current rule changes after 10 correct sortings. Persisting on a correct strategy with positive feedback, while trying to determine the existing rule or after the rule is already determined, is rated as a “conceptual-level response” (CLR). Insisting on the previous response after the rule has been changed, as indicated by repeated negative feedback, is rated as a “perseverative response” (PR). Impersistance in the correct rule after reaching a conceptual response level is rated as a “failure to maintain set” (FMS). The test is finished after 6 correct sortings or having two 64-deck cards expired, which gives a “number of completed categories” (CC) score.
The Tower of London Test26 is a test of planning ability in which the subject has to solve positional problems by moving three colored beads, one at a time, among three sticks with different heights. The problem must be solved by starting from an initial position and ending with a pre-specified end-position, with a minimum number of moves and within the shortest time. The necessary moves must be planned in advance and executed as fast as possible within the permitted rules.
The Stroop Test27 includes a task for assessing complex selective attention and interference control as an executive function. The interference task of the test consists of the color words which are differently colored from what the word denotes. The subject is required to name the color of the word, trying to inhibit the interference of the automatic response tendency of reading the word, instead.
The Trail-Making Test (TMT)27 consists of Part A (TMT-A) and Part B (TMT-B). TMT-A is a measure of psychomotor speed in which the subject uses a pencil to connect numbered circles scattered on a sheet of paper in an ascending order, and time-to-complete is recorded as its score. TMT-B is used to assess the ability of set-shifting as an executive function and visuospatial working memory. The setting in the TMT-B is similar to TMT-A, but this time numbered circles are scattered with circled letters, and the task is to connect circles again in ascending order by shifting, each time, between a digit and a letter. In order to obtain a purer measure of set-shifting, likely psychomotor speed delays are corrected by subtracting the duration of TMT-A from the duration of TMT-B, that is the TMT B−A score.
The Verbal Fluency Tests27 are measures of perseverance and sustained behavioral output. In this particular version, subjects are asked to name as many words as possible that are animals within 1 minute (semantic fluency) and as many words as possible that begin with letters K, A, and S, within 1 minute for each letter (lexical fluency).
The Stroop Test27 includes a task for assessing complex selective attention and interference-control as an executive function. The interference task of the test consists of the color words, which are incongruously colored from what the word denotes. The subject is required to name the color of the word trying to inhibit the interference of the automatic response tendency of reading the word, instead.
Statistical Analysis
SPSS 11.5 for Windows was used for statistical analyses. For comparisons between the two groups, t-test were used for continuous variables, and χ2 test was used for categorical variables. Fisher’s exact test was used when indicated.
One-way ANOVA was applied for continuous variables for the comparisons among the four groups. Post-hoc comparisons were made with Bonferroni tests.
Results
There were no significant differences between the Patient and Control groups with respect to age (respectively, 28.2 [standard deviation {SD}: 8.1] and 27.5 [7.5]; t=0.71; NS) and female ratio (respectively, 62.4% and 59.0%; χ2=0.24; NS). The mean age at onset was 22.1 (SD: 6.7); the mean duration of illness was 7.5 (SD: 6.4) years; the mean Y-BOCS-Obsession score was 13.2 (SD: 2.9); the mean Y-BOCS-Compulsion score was 12.4 (SD: 3.2); the mean Y-BOCS-total score was 25.5 (SD: 5.2), and the mean Ham-D score was 6.9 (SD: 3.8) in the OCD group.
The distribution of COMT Val158Met polymorphism did not deviate from the Hardy-Weinberg equilibrium. The allele and genotype distributions of COMT Val158Met polymorphism in OCD and control groups are shown in Table 2. There was no significant difference for the genotype distributions between the OCD and control groups (χ2=0.26; NS).
| Genotype (frequency) | Allele (frequency) | ||||||
|---|---|---|---|---|---|---|---|
| Val/Val | Val/Met | Met/Met | χ2 | p | Val | Met | |
| Total | |||||||
| OCD | 26 (0.257) | 52 (0.515) | 23 (0.228) | 0.26 | 0.9 | 104 (0.515) | 98 (0.485) |
| Control | 23 (0.230) | 52 (0.520) | 25 (0.250) | 98 (0.490) | 102 (0.510) | ||
| Men | |||||||
| OCD | 14 (0.368) | 19 (0.500) | 5 (0.132) | 5.79 | 0.055 | 47 (0.618) | 29 (0.382) |
| Control | 8 (0.195) | 19 (0.463) | 14 (0.341) | 35 (0.427) | 47 (0.573) | ||
| Women | |||||||
| OCD | 12 (0.190) | 33 (0.524) | 18 (0.186) | 1.89 | 0.39 | 57 (0.452) | 69 (0.548) |
| Control | 15 (0.254) | 33 (0.559) | 11 (0.186) | 63 (0.534) | 55 (0.466) | ||
OCD: obsessive-compulsive disorder; COMT: catechol-O-methyltransferase.
The two groups were not significantly different in terms of male-to-female ratio and years of education (Table 3). The age at onset in Met allele carriers was found to be significantly lower, compared with the Val/Val group (t=2.37; p=0.02; Table 3). The mean scores of the Y-BOCS-Obsession, Y-BOCS-Compulsion, and Y-BOCS-total were similar for the two groups (Table 3).
| Val/Val (N=26) | Met Carriers (N=75) | χ2 | p | |
|---|---|---|---|---|
| N (%) | N (%) | |||
| Men | 14 (53.8) | 24 (32.0) | 3.93 | 0.06 |
| mean (SD) | mean (SD) | T | p | |
| Education, years | 11.4 (4.1) | 11.1 (3.9) | 0.25 | 0.81 |
| Age at onset, years | 22.6 (7.6) | 18.8 (6.7) | 2.37 | 0.02 |
| Duration of illness, years | 5.4 (5.0) | 8.2 (6.7) | –1.83 | 0.069 |
| Y-BOCS-Obsession | 14.1 (2.7) | 12.9 (2.9) | 1.82 | 0.07 |
| Y-BOCS-Compulsion | 12.3 (3.2) | 12.5 (3.3) | –0.23 | 0.82 |
| Y-BOCS-Total | 26.0 (5.5) | 25.4 (5.1) | 0.51 | 0.61 |
OCD: obsessive-compulsive disorder; Y-BOCS: Yale-Brown Obsessive-Compulsive Scale.
One-way ANOVA comparisons among the four subgroups and their post-hoc evaluation revealed that the OCD-Met carrier subgroup’s performance was significantly poorer than the other groups on a number of measures: the mean scores of the TMT-A and TMT-B were longer, as compared with the HS-Met carrier subgroup, and the mean score of the TMT B−A was longer and lexical fluency was lower as compared with the both subgroups of healthy-controls (Table 4). Another finding was that the mean score for lexical fluency was higher in the HS-Val/Val subgroup than in the other three subgroups (Table 4).
| OCD Patients | Control Subjects | |||||||
|---|---|---|---|---|---|---|---|---|
| Val/Val (N=15) | Met Carriers (N=60) | Val/Val (N=11) | Met Carriers (N=37) | Partial η2 | F | p | ||
| Executive Functions | ||||||||
| Wisconsin Card-Sorting Test | ||||||||
| Perseverative errors, % | 14.1a (7.7) | 19.1a (13.3) | 16.3a (11.5) | 16.5a (10.7) | 0.02 | 0.89 | 0.45 | |
| Categories completed | 4.8a (1.4) | 4.5a (1.8) | 5.3a (1.1) | 4.8a (1.4) | 0.02 | 0.89 | 0.45 | |
| Failure to maintain set | 0.5a (0.9) | 0.7a (0.9) | 0.6a (0.8) | 0.7a (0.8) | 0.007 | 0.29 | 0.83 | |
| Conceptual-level responses | 62.6a (19.0) | 55.8a (20.1) | 73.0a (14.6) | 63.7a (20.1) | 0.07 | 3.00 | 0.03 | |
| Planning | ||||||||
| Tower of London | ||||||||
| Total correct | 2.9a (2.6) | 3.1a (2.1) | 3.6a (1.6) | 3.3a (2.6) | 0.008 | 0.28 | 0.83 | |
| Number of moves | 37.7a (21.4) | 42.7a (22.0) | 30.9a (17.7) | 37.9a (19.6) | 0.03 | 1.13 | 0.34 | |
| Time-to-first-move, sec. | 47.9a (35.5) | 38.0a (21.7) | 51.3a (25.5) | 48.6a (47.2) | 0.03 | 0.98 | 0.41 | |
| Total time-to-complete, sec. | 257.2a (93.6) | 290.3a (161.3) | 304.5a (216.8) | 260.7a (163.4) | 0.01 | 0.41 | 0.74 | |
| Total time, failures | 0.4a (0.9) | 1.0a (1.6) | 0.8a (0.8) | 1.0a (1.5) | 0.17 | 0.62 | 0.61 | |
| Trail-Making Test (TMT) | ||||||||
| TMT-A, sec. | 43.5a,b (18.9) | 43.3a (18.1) | 38.6a,b (26.8) | 30.0b (11.0) | 0.11 | 4.87 | 0.003 | |
| TMT-B, sec. | 88.3a,b (35.8) | 123.3a (79.4) | 70.0a,b (42.9) | 72.1b (47.5) | 0.13 | 5.92 | 0.001 | |
| TMT B−A, sec. | 44.7a,b (33.9) | 79.9a (68.3) | 31.4b (28.0) | 42.1b (41.4) | 0.12 | 5.30 | 0.002 | |
| Verbal Fluency | ||||||||
| Semantic fluency: animal names | 21.1a (4.5) | 20.2a (4.7) | 23.5a (7.2) | 22.7a (4.1) | 0.07 | 2.91 | 0.038 | |
| Lexical fluency: K-A-S | 14.8a,c (5.4) | 13.4a (4.6) | 22.0b (7.0) | 16.9c (5.8) | 0.19 | 9.51 | <0.001 | |
| Resistance to Interference | ||||||||
| Stroop Test | ||||||||
| Interference time, sec. | 44.1a (13.1) | 41.7a (14.6) | 38.2a (13.3) | 36.0a (13.37) | 0.04 | 1.79 | 0.15 | |
Means in a row with different subscript letters indicate significant differences (p <0.05) according to the Bonferroni post-hoc test. OCD: obsessive-compulsive disorder.
There were no significant differences among the four groups on the WCST, Stroop Test, or Tower of London Test measures, other tasks related to executive function (Table 4).
Discussion
We found no significant difference for the COMT Val158Met genotype distributions between the OCD and control groups. Being a Met-carrier was seemingly disadvantageous for OCD patients in our study, as reflected by their poorer performance on measures of TMT B−A and lexical fluency.
Findings from the investigations of a possible role for a COMT Val158Met polymorphism in OCD have provided conflicting results. Some studies reported that COMT Val158Met polymorphism was associated with OCD,28–32 while others found no association with susceptibility to OCD.33–35 The results of a meta-analysis indicate that the association between COMT Met158 and OCD was present in men but not in women.18 In our case–control analysis comparing OCD patients and HS, no significant differences in the allele or genotype frequencies of COMT Val158Met polymorphism were seen, similar to studies showing negative associations.
Our results suggest that OCD patients carrying the Met allele, who have a less active COMT enzyme and higher prefrontal DA levels, had earlier onset. On the other hand, we found no differences in Y-BOCS scores between the Val/Val and Met-carriers groups. In two studies that investigated the relationship between YBOCS severity score and the COMT Val158Met genotype, one reported an association between the high-activity genotype and increased YBOCS-severity scores in young men with recent-onset schizophrenia,36 whereas the other did not find any difference in YBOCS-severity scores between patients with different COMT Val158Met genotypes.30
Several studies have demonstrated that the Met allele is associated with better performance on tests of prefrontally-mediated cognition. It was found that TMT-B scores shared approximately 14% of variance with Met dose in schizophrenia, whereas the WCST perseverative error score shared only 2%.12 Authors suggested that the functions most closely linked to the COMT gene polymorphism are those shared by tests such as the TMT and Digit Symbol Substitution tests, which are complex and involve a range of attentional, executive, visuospatial, and graphomotor abilities.12
The low-activity Met allele of the COMT gene has been associated with better performance in the WCST in relatives of schizophrenia patients,10 in healthy-control subjects,9 and in heterogeneous samples in which schizophrenia patients grouped together with healthy controls.8,13 It has also been reported that homozygosity for the Met allele is associated with better performance on the N-Back-Test,37 a test of working memory, in schizophrenia patients and on the TMT in healthy subjects.11
In a study with healthy men, C/C subjects with the COMT C/G rs4818 polymorphism, with low COMT activity and high DA levels, exhibited a poorer IGT performance than subjects homozygous for the G allele with high COMT activity and low DA levels, the exact opposite was true for the performance in a planning task (i.e., the Stockings of Cambridge Test).16 The authors interpreted their findings as the differential effects of prefrontal dopamine levels on non-emotional problem-solving and emotionally-informed decision-making, the higher the better for the former, and lower the better for the latter. A support for their conclusion that the high prefrontal dopamine levels are disadvantageous for emotionally-guided decision-making came from a study by van den Bos et al.,17 reporting that subjects homozygous for Met allele more often chose cards from disadvantageous decks in IGT than subjects homozygous for valine. On the other hand, no association was found between the COMT polymorphism and perseverative errors in the Wisconsin Card-Sorting Test in healthy women15 or IGT performance in college students.14
We found an association between the Met/Met or Val/Met genotype, which leads to low enzyme activity, and lower performance on some of the neurocognitive tests measuring executive functions in OCD patients. Regarding the scores for TMT B−A and lexical fluency, the Met-carrier OCD patients performed worse than the Val/Val and Met-carrier healthy-controls. Our results are in line with the previous findings of Roussos et al.,16 and van den Bos et al.,17 suggesting that low COMT activity and a high prefrontal DA level may be related to poor IGT performance in healthy subjects, although considerable evidence has shown that the Met allele of the COMT Val158Met and higher prefrontal DA level are related to better executive functioning, especially in patients with schizophrenia or in their unaffected relatives.8,10,12,13,37
There is an extensive literature on differential effects of both dopaminergic deficits with nigral cell loss and its excess by dopaminergic-replacement therapy on cognition in Parkinson's disease (PD),38–43 implying a positive effect of dopaminergic-replacement on the standard executive tests and a negative effect of excess dopamine on tasks tapping learning from negative feedback and emotional decision-making such as IGT. A recent study in PD showed that the differential effect of dopamine as a result of COMT polymorphism on cognition may even display a temporal pattern on the same task.44 Patients were followed up longitudinally for 5 years. The initial superiority of the Val homozygous group over Met homozygotes on the Tower of London task, a non-emotional problem-solving, planning, executive test, was reversed over time to the Met group’s advantage. The authors commented that, in “early” disease, when dopaminergic activity appears to be upregulated in the prefrontal cortex, low COMT activity, corresponding to further elevation of dopamine levels, is detrimental to performance. In “later” disease, when prefrontal dopamine levels fall, this effect disappears and may even reverse. In this respects parallels can be drawn between the early PD and OCD, and between late PD and schizophrenia.
A role for DA in the pathophysiology of OCD is supported by the observation that DA receptor-agonists such as methylphenidate, amphetamine, and cocaine, may induce obsessive-compulsive symptoms.45,46 Also, there is sufficient evidence demonstrating the efficacy of augmentation with antipsychotics for treatment-refractory OCD patients.47 More recently, SPECT studies provided evidence for higher DA transporter densities in tandem with a down-regulation of the D2 receptor in patients with OCD relative to controls, which suggests higher synaptic concentrations of DA in the basal ganglia in OCD.46 In all, the results of these preclinical and clinical studies provide growing evidence suggesting an increased dopaminergic neurotransmission in OCD.
It seems that both excessive prefrontal dopaminergic activity, such as in OCD, and deficient activity, such as in schizophrenia, lead to executive dysfunction. Lower activity of the COMT associated with the Met allele leading to even higher levels of DA in the prefrontal cortex,5,6 may enhance the executive deficits in OCD patients, whereas the high-activity form of COMT associated with the Val allele leads to even lower dopaminergic state in schizophrenic patients, resulting in more severe executive dysfunction in those patients.8–12
The major limitation of this study is the relatively small sample size, and the results regarding cognitive functions require replication in larger samples. Despite this limitation, two well-defined confounding factors in neuropsychological studies of OCD, such as medication and comorbidity, particularly the presence of comorbid depression, were carefully controlled in our study.
In conclusion, we found no significant difference for the COMT Val158Met genotype distributions between the OCD and control groups. On the other hand, our results suggest that Val/Val genotype has a positive effect on executive functions, as assessed using the TMT B−A and lexical fluency, and also may interact with age at onset of OCD. Although effects of COMT genotype on cognitive functioning have been investigated extensively in healthy subjects and schizophrenia patients, they have not been well-characterized in OCD patients yet. Further investigations with a large number of patients need to be conducted in order to determine the impact of the COMT polymorphisms on clinical characteristics and cognitive functions in patients with OCD.
References
1.
Gogos JA, Morgan M, Luine V, et al.: Catechol-O-methyltransferase-deficient mice exhibit sexually dimorphic changes in catecholamine levels and behavior. Proc Natl Acad Sci U S A 1998; 95:9991–9996
2.
Karoum F, Chrapusta SJ, Egan MF: 3-Methoxytyramine is the major metabolite of released dopamine in the rat frontal cortex: reassessment of the effects of antipsychotics on the dynamics of dopamine release and metabolism in the frontal cortex, nucleus accumbens, and striatum by a simple two pool model. J Neurochem 1994; 63:972–979
3.
Yavich L, Forsberg MM, Karayiorgou M, et al.: Site-specific role of catechol-O-methyltransferase in dopamine overflow within prefrontal cortex and dorsal striatum. J Neurosci 2007; 27:10196–10209
4.
Lachman HM, Papolos DF, Saito T, et al.: Human catechol-O-methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics 1996; 6:243–250
5.
Chen J, Lipska BK, Halim N, et al.: Functional analysis of genetic variation in catechol-O-methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet 2004; 75:807–821
6.
Lotta T, Vidgren J, Tilgmann C, et al.: Kinetics of human soluble and membrane-bound catechol O-methyltransferase: a revised mechanism and description of the thermolabile variant of the enzyme. Biochemistry 1995; 34:4202–4210
7.
Sheldrick AJ, Krug A, Markov V, et al.: Effect of COMT val158met genotype on cognition and personality. Eur Psychiatry 2008; 23:385–389
8.
Egan MF, Goldberg TE, Kolachana BS, et al.: Effect of COMT Val108/158 Met genotype on frontal lobe function and risk for schizophrenia. Proc Natl Acad Sci U S A 2001; 98:6917–6922
9.
Malhotra AK, Kestler LJ, Mazzanti C, et al.: A functional polymorphism in the COMT gene and performance on a test of prefrontal cognition. Am J Psychiatry 2002; 159:652–654
10.
Rosa A, Peralta V, Cuesta MJ, et al.: New evidence of association between COMT gene and prefrontal neurocog-nitive function in healthy individuals from sibling pairs discordant for psychosis. Am J Psychiatry 2004; 161:1110–1112
11.
Wishart HA, Roth RM, Saykin AJ, et al.: COMT Val158Met genotype and individual differences in executive function in healthy adults. J Int Neuropsychol Soc 2011; 17:174–180
12.
Bilder RM, Volavka J, Czobor P, et al.: Neurocognitive correlates of the COMT Val(158)Met polymorphism in chronic schizophrenia. Biol Psychiatry 2002; 52:701–707
13.
Joober R, Gauthier J, Lal S, et al.: Catechol-O-methyltransferase Val-108/158-Met gene variants associated with performance on the Wisconsin Card Sorting Test. Arch Gen Psychiatry 2002; 59:662–663
14.
Kang JI, Namkoong K, Ha RY, et al.: Influence of BDNF and COMT polymorphisms on emotional decision-making. Neuropharmacology 2010; 58:1109–1113
15.
Tsai SJ, Yu YW, Chen TJ, et al.: Association study of a functional catechol-O-methyltransferase-gene polymorphism and cognitive function in healthy females. Neurosci Lett 2003; 338:123–126
16.
Roussos P, Giakoumaki SG, Pavlakis S, et al.: Planning, decision-making, and the COMT rs4818 polymorphism in healthy males. Neuropsychologia 2008; 46:757–763
17.
van den Bos R, Homberg J, Gijsbers E, et al.: The effect of COMT Val158 Met genotype on decision-making and preliminary findings on its interaction with the 5-HTTLPR in healthy females. Neuropharmacology 2009; 56:493–498
18.
American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM-IV). Washington, DC, American Psychiatric Press, 1994
19.
First MB, Spitzer RL, Gibbon M, et al.: Structured Clinical Interview for DSM-IV, Clinical Version (SCID-I/CV). Washington, DC, American Psychiatric Press, 1997
20.
Goodman WK, Price LH, Rasmussen SA, et al.: The Yale-Brown Obsessive Compulsive Scale, I: development, use, and reliability. Arch Gen Psychiatry 1989; 46:1006–1011
21.
Goodman WK, Price LH, Rasmussen SA, et al.: The Yale-Brown Obsessive Compulsive Scale, II: validity. Arch Gen Psychiatry 1989; 46:1012–1016
22.
Hamilton M: Development of a rating scale for primary depressive illness. Br J Soc Clin Psychol 1967; 6:278–296
23.
Ruiz-Sanz JI, Aurrekoetxea I, Ruiz del Agua A, et al.: Detection of catechol-O-methyltransferase Val158Met polymorphism by a simple one-step tetra-primer amplification refractory mutation system-PCR. Mol Cell Probes 2007; 21:202–207
24.
Heaton RK: Wisconsin Card Sorting Test manual. Florida, Psychological Assessment Resources, 1981
25.
Culbertson WC, Zillmer EA: Tower of London, Drexel University, 2nd Edition, Technical Manual. Toronto, Canada, Multi-Health Systems, 2005.
26.
Spreen O, Strauss E: A Compendium of Neuropsychological Tests: Administration, Norms and Commentary. New York, Oxford University Press, 1991
27.
Denys D, Van Nieuwerburgh F, Deforce D, et al.: Association between the dopamine D2 receptor TaqI A2 allele and low-activity COMT allele with obsessive-compulsive disorder in males. Eur Neuropsychopharmacol 2006; 16:446–450
28.
Karayiorgou M, Altemus M, Galke BL, et al.: Genotype determining low catechol-O-methyltransferase activity as a risk factor for obsessive-compulsive disorder. Proc Natl Acad Sci U S A 1997; 94:4572–4575
29.
Katerberg H, Cath DC, Denys DA, et al.: The role of the COMT Val(158)Met polymorphism in the phenotypic expression of obsessive-compulsive disorder. Am J Med Genet B Neuropsychiatr Genet 2010; 153B:167–176
30.
Liu S, Liu Y, Wang H, et al.: Association of catechol-O-methyl transferase (COMT) gene -287A/G polymorphism with susceptibility to obsessive-compulsive disorder in Chinese Han population. Am J Med Genet B Neuropsychiatr Genet 2011; 156B:393–400
31.
Poyurovsky M, Michaelovsky E, Frisch A, et al.: COMT Val158Met polymorphism in schizophrenia with obsessive-compulsive disorder: a case–control study. Neurosci Lett 2005; 389:21–24
32.
Erdal ME, Tot S, Yazici K, et al.: Lack of association of catechol-O-methyltransferase gene polymorphism in obsessive-compulsive disorder. Depress Anxiety 2003; 18:41–45
33.
Meira-Lima I, Shavitt RG, Miguita K, et al.: Association analysis of the catechol-o-methyltransferase (COMT), serotonin transporter (5-HTT) and serotonin 2A receptor (5HT2A) gene polymorphisms with obsessive-compulsive disorder. Genes Brain Behav 2004; 3:75–79
34.
Ohara K, Nagai M, Suzuki Y, et al.: No association between anxiety disorders and catechol-O-methyltransferase polymorphism. Psychiatry Res 1998; 80:145–148
35.
Pooley EC, Fineberg N, Harrison PJ: The met(158) allele of catechol-O-methyltransferase (COMT) is associated with obsessive-compulsive disorder in men: case–control study and meta-analysis. Mol Psychiatry 2007; 12:556–561
36.
Zinkstok J, van Nimwegen L, van Amelsvoort T, et al.: Catechol-O-methyltransferase gene and obsessive-compulsive symptoms in patients with recent-onset schizophrenia: preliminary results. Psychiatry Res 2008; 157:1–8
37.
Goldberg TE, Egan MF, Gscheidle T, et al.: Executive subprocesses in working memory: relationship to catechol-O-methyltransferase Val158Met genotype and schizophrenia. Arch Gen Psychiatry 2003; 60:889–896
38.
Alexander GE, Crutcher MD, DeLong MR: Basal ganglia-thalamocortical circuits: parallel substrates for motor, oculomotor, “prefrontal,” and “limbic” functions. Prog Brain Res 1990; 85:119–146
39.
Frank MJ, Seeberger LC, O’Reilly RC: By carrot or by stick: cognitive reinforcement learning in parkinsonism. Science 2004; 306:1940–1943
40.
Franken IH, Booij J, van den Brink W: The role of dopamine in human addiction: from reward to motivated attention. Eur J Pharmacol 2005; 526:199–206
41.
Lange KW, Robbins TW, Marsden CD, et al.: L-dopa withdrawal in Parkinson’s disease selectively impairs cognitive performance in tests sensitive to frontal lobe dysfunction. Psychopharmacology (Berl) 1992; 107:394–404
42.
Shohamy D, Myers CE, Grossman S, et al.: Cortico-striatal contributions to feedback-based learning: converging data from neuroimaging and neuropsychology. Brain 2004; 127:851–859
43.
Wolters ECh, van der Werf YD, van den Heuvel OA: Parkinson’s disease-related disorders in the impulsive-compulsive spectrum. J Neurol 2008; 255(Suppl 5):48–56
44.
Williams-Gray CH, Evans JR, Goris A, et al.: The distinct cognitive syndromes of Parkinson’s disease: 5 year follow-up of the CamPaIGN cohort. Brain 2009; 132:2958–2969
45.
Denys D, Zohar J, Westenberg HG: The role of dopamine in obsessive-compulsive disorder: preclinical and clinical evidence. J Clin Psychiatry 2004; 65(Suppl 14):11–17
46.
Westenberg HG, Fineberg NA, Denys D: Neurobiology of obsessive-compulsive disorder: serotonin and beyond. CNS Spectr 2007; 12(Suppl 3):14–27
47.
Bloch MH, Landeros-Weisenberger A, Kelmendi B, et al.: A systematic review: antipsychotic augmentation with treatment-refractory obsessive-compulsive disorder. Mol Psychiatry 2006; 11:622–632
Information & Authors
Information
Published In
History
Received: 24 April 2012
Revision received: 16 September 2012
Accepted: 24 September 2012
Published online: 1 July 2013
Published in print: Summer 2013
Authors
Funding Information
The authors of this study have no financial conflicts of interest. This work was supported by the Research Fund of the Istanbul University (BYPS-12-5/131206).
Metrics & Citations
Metrics
Citations
Export Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.
For more information or tips please see 'Downloading to a citation manager' in the Help menu.
View Options
View options
PDF/EPUB
View PDF/EPUBLogin options
Already a subscriber? Access your subscription through your login credentials or your institution for full access to this article.
Personal login Institutional Login Open Athens loginNot a subscriber?
PsychiatryOnline subscription options offer access to the DSM-5-TR® library, books, journals, CME, and patient resources. This all-in-one virtual library provides psychiatrists and mental health professionals with key resources for diagnosis, treatment, research, and professional development.
Need more help? PsychiatryOnline Customer Service may be reached by emailing [email protected] or by calling 800-368-5777 (in the U.S.) or 703-907-7322 (outside the U.S.).