Glucocorticoid Receptor Genetic Variants and Response to Fluoxetine in Major Depressive Disorder
Publication: The Journal of Neuropsychiatry and Clinical Neurosciences
Abstract
Hyperactivity of the hypothalamic pituitary adrenocortical (HPA) axis is one of the main clinical findings in depression. The HPA axis is interrelated with glucocorticoid signaling via glucocorticoid receptors (GCRs). Thus, functional genetic variants on GCRs might influence therapeutic outcomes in depression. The aim of the present study was to investigate the association between three functional polymorphisms (rs41423247, rs6195, and rs6189/rs6190) on GCR and response to fluoxetine in a group of depressed patients. One hundred newly diagnosed patients completed 6 weeks of fluoxetine treatment. Response to treatment was defined as a 50% decrease in the Hamilton Depression Rating Scale score. Variants of rs41423247, rs6195, and rs6189/rs6190 polymorphisms were determined in extracted DNAs using PCR-RFLP method. Regarding rs41423247 polymorphism, carriers of the CG and GG genotype responded significantly better to fluoxetine compared with CC carriers (p=0.008, OR=3.3, 95% CI=1.35–8.07). Moreover, the G allele of rs41423247 polymorphism was strongly associated with response to fluoxetine (p=0.032, OR=2.2, 95% CI=1.09–4.44). There was no significant association between different genotypes and alleles of rs6195, rs6189/rs6190 variants, and response to fluoxetine (p=0.213 and 0.99, respectively). In conclusion, rs41423247 polymorphism might be a predictor for better response to fluoxetine. These findings support the idea that some variants of the GCR might contribute to interindividual variability of response to antidepressants.
Major depressive disorder (MDD), a prevalent psychological disorder associated with considerable morbidity,1 is the third leading cause of disability worldwide and the first in middle- to high-income countries.2 Almost 350 million people worldwide are suffering from MDD, among whom only 25% receive effective cure.3 Based on a World Health Organization report, the prevalence of depression in Asia and Africa is less compared to America and Europe.2 Research has shown that along with environmental parameters, endogenous factors contribute substantially to the development of MDD.4–6 Moreover, the role of genetic and epigenetic factors as the main contributors to this illness is further pronounced.7
Dysregulation of hypothalamic-pituitary-adrenocortical (HPA) system activity is one of the major neuroendocrine abnormalities in MDD, resulting in elevated plasma levels of corticotropin and cortisol.8,9 Function of the HPA axis interrelates with glucocorticoid (GC) signaling, which is disrupted in MDD,10–12 as well as perfectionism13 and other pathologic conditions, such as metabolic syndrome14 and asthma.15 GCs regulate the HPA axis through binding to GC receptors (GCRs). These receptors are expressed in almost every part of the body, such as several regions of the forebrain.16 There are reports on the impact of forebrain GCRs in HPA axis function in depression-like behavior, which highlight the role of GCRs in the development of MDD10 and at the same time propose therapeutic implications. Alongside the reduction in GCR mRNA levels in brain areas like the hippocampus and the frontal cortex in MDD patients,10 some studies have reported an association between polymorphisms in the GCR and MDD.17–19 Further evidence is provided by Won et al.,20 who argue the possible influence of GCR genetic variants on hippocampal shape and integrity of parahippocampal subdivision of the cingulum in MDD. The structural changes secondary to the GCR altered activity can also explain the association between different variants of GCR and childhood depression in Castellini’s report.21 Other psychiatric conditions with close ties with GCR activity include posttraumatic stress disorder (PTSD)22 and suicidal thoughts and behavior,23 which are reportedly associated with GCR genetic variations.
Antidepressants are believed to stimulate GCR function and expression in human and animal models of depression.24–27 They induce GCR nuclear translocation and transactivation mediated by the cyclic adenosine monophosphate (cAMP)/protein kinase A (PKA) cascade. The negative feedback of GCR on HPA axis in turn reduces HPA-axis activity.26,28,29 Altogether, these observations make the GCR gene a prime candidate for associations with altered clinical response to antidepressant drugs. Among the antidepressants, selective serotonin reuptake inhibitors are common first-line treatments,30 and fluoxetine is frequently prescribed because of its efficacy and tolerability.31 Fluoxetine is efficacious for MDD in all ages, although more in adults and youths compared with geriatric individuals.32 It can inhibit the steroid transporters present in neurons and the blood-brain barrier as well, resulting in an increased amount of cortisol in the brain, which negatively balances the HPA axis.33
There is no doubt that pharmacotherapy has alleviated morbidity of individuals with depression, but only 30%−40% of patients seem to respond completely to treatment.34 The hypothesis of this study is based on these observations and the interplay of fluoxetine with GCRs, which suggest clues for differential therapeutic response to fluoxetine upon the inheritance of different genotypes of GCRs. In the present study, we assessed the clinical response to fluoxetine to investigate whether the three polymorphisms in GCR, including rs41423247, rs6195, and rs6189/rs6190, might have any influence on response to treatment in a sample of depressed patients.
Methods
This work was carried out in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) and Uniform Requirements for manuscripts submitted to biomedical journals. The study was approved by the local committee for ethics of medical experiments on human subjects of Shiraz University of Medical Sciences. The written consent was obtained from the participants prior to the interview. All patients were of Caucasian origin from the same geographical area.
Patients with MDD were recruited from Hafiz Hospital in Shiraz, Iran, between 2011 and 2012. All patients were at least 18 years old, with the diagnosis of MDD according to the DSM-V criteria.35 A total of100 newly diagnosed MDD patients, defined as a negative previous diagnosis of depression and no history of antidepressant medications use, were included in the study (male: 33, female: 67, mean age±SD=32.87±10.65). The 21-item Hamilton Depression Rating Scale (HAM-D) was used to evaluate the severity of depression.26 Exclusion criteria were as follows: a family history of schizophrenia, a personal history of bipolar disorder, a family history of bipolar disorder in first-degree relatives, a personal history of schizophrenia, manic or hypomanic episode, mood incongruent psychotic symptoms, active substance dependence, current treatment with antipsychotics or mood stabilizers, and significant medical conditions.
Drug Administration
Fluoxetine (FLUOXETINE-ABIDI) was administered at a fixed-dose regimen of 20 mg for one week initially, followed by dosages of 20–80 mg/day according to clinical response over the 6-week treatment duration. Only hypnotics such as zolpidem or anxiolytics such as chlordiazepoxide were allowed for severe anxiety. A positive clinical response to fluoxetine treatment was considered if at least 50% reduction in the baseline HAM-D score was observed through the sixth week. Evaluations were done at baseline and weeks 1 and 6 of treatment.
Prior to interviewing, 5 ml of venous blood samples were collected for further genotyping.
DNA Extraction and Genotyping
Genomic DNAs were extracted from whole blood using a standard method.36
PCR amplification of rs41423247, rs6195, and rs6189/rs6190 was carried out using primers mentioned in Table 1. The PCR protocol included 1 cycle of denaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 1 minute, annealing at 55°C for 1.5 minutes (except for rs6195 polymorphism [exon 2–5] at 51°C), extension at 72°C for 1.5 minutes, and a final cycle at 72°C for 5 minutes.
| Polymorphisms | Primer Sequence (5′–3′) | DNA Base Pair | Restriction Enzyme Digestion | DNA Fragment Size (Base Pair) | Tm | References |
|---|---|---|---|---|---|---|
| rs41423247 | F–5_TGCTGCCTTATTTGTAAATTCGT –3 | 335 | BclI | 335/222/117 | 53.70 | Bachmann et al. 200561 |
| R–5_AAGCTTAACAATTTTGGCCATC –3 | 52.24 | |||||
| rs6195 | F–5_AGTACCTCTGGAGGACAGAT_3 | 243 | Tsp509I | 153/134/95/19 | 51.96 | Huizenga et al. 199862 |
| R–5_GTCCATTCTTAAGAAACAGG_3 | 47.20 | |||||
| rs6189/rs6190 | F–5_TGCATTCGGAGTTAACTAAAAAG_3 | 448 | MnlI | 184/163/149/50/49/35 | 51.92 | Panek et al. 201463 |
| R–5_ATCCCAGGTCATTTCCCATC _3 | 52.48 |
Restriction fragment-length PCR (RFLP) analysis was performed to determine genotype frequencies.
Forrs41423247 polymorphism, 5μL of relevant PCR product (335 base pair [bp]) was digested by 10 units of rs41423247 restriction endonuclease (Roche Applied Science, Mannheim, Germany) for 3–16 hours at 37°C.
The CC genotype produced two bands (117 and 222 bp), the CG variant gave three fragments (117, 222, and 335 bp), and the GG genotype remained undigested (335 bp).
The rs6189/rs6190 polymorphism genotypes were determined by digesting 10μL of relevant PCR product (448 bp) with 1.25 μL of MnlI restriction enzyme (New England Biolabs, Beverly, MA) at 37°C for 3–16 hours. Endonuclease digestion yielded fragments of 142 and 163 bp for the wild-type allele (ER22/23ER genotype); heterozygous allele (ER22/23EK genotype) appeared as three bands of 142, 163, and 177 bp; and homozygous allele (EK22/23EK genotype) gave 163 and 177 bp fragments.
To determine rs6195 polymorphism genotypes, 10μL of relevant PCR product (243 bp) were digested with 5 μL of Tsp509I restriction endonuclease (New England Biolabs, Beverly, MA) for 3–16 hours at 65°C. Digestion produced 3 fragments of 19, 95, and 134 bp (wild type allele, N363N) or two bands of 95 and 153 bp (heterozygous mutant allele, N363S).
Digested fragments were separated by electrophoresis on agarose (InvitrogensUltraPure) gel 2% after 3–16 hours of incubation (Table 1). They were then stained by ethidium bromide and visualized in an ultraviolet transilluminator. It is important to mention that all of the samples were genotyped at least twice and reconfirmed.
Statistics
Data were analyzed using SPSS 21.0 for Windows (SPSS Inc., Chicago). Hardy–Weinberg equilibrium (HWE) for distribution of genotypes was calculated using chi-square test. Continuous variables are demonstrated as mean±SD. Genotype frequencies are shown in percentage (%). Distribution of all continuous variables was tested for normal distribution with the Kolmogorov–Smirnov test. Associations between categorical variables were determined by Pearson's chi-square or Fisher's exact test and for interval data by Student's t test. Univariate analysis of genotypes was performed using chi-square test. Odds ratio (OR) and 95% confidence intervals (CI) were obtained. We also analyzed the distribution of genotype frequencies under three different genetic models (additive [CC=0, CG=1, GG=2], recessive [CC and CG versus GG], and dominant [CG and GG versus CC]), using the SNPassoc package RV.3.0.1 (http://www.Rproject.org).37 A p value <0.05 was considered as statistically significant.
Results
A total of 100 MDD patients were included in this study. In terms of response, 70 patients (70%) were responders to fluoxetine (baseline HAM-D: 23.8±6.9; HAM-D after week 6: 6.2±4.8). Table 2 demonstrates patients’ demographic information.
| Parameter | Mean±SD |
|---|---|
| Height (cm) | 165.86±8.24 |
| Weight (kg) | 67.97±11.92 |
| Age (years) | 32.58±10.68 |
| Sex (%) | |
| Female | 67 |
| Male | 33 |
| BMI (kg/m2) | 24.76±0.38 |
a
BMI: body mass index.
Table 3 shows genotype and allele frequencies of patients receiving fluoxetine based on 50% score reduction. The distribution of study genotypes was in agreement with Hardy-Weinberg equilibrium. Regarding rs41423247 polymorphism, carriers of CG and GG genotype responded significantly better to fluoxetine compared with CC carriers (p=0.008, OR=3.3, 95% CI=1.35–8.07; Fisher's exact test, two-sided). Moreover, the G allele of rs41423247 polymorphism was strongly associated with response to fluoxetine (p=0.032, OR=2.2, 95% CI=1.09–4.44; Fisher's exact test, two-sided). Further analysis under log-additive, recessive, and dominant models for rs41423247 revealed that log additive and dominant models are, respectively, 2.41 (95% CI=1.13–5.14) and 3.31 (95% CI=1.36–8.07) times more likely to respond to fluoxetine (Table 4).
| Polymorphism | Genotype | Responders (N=70) | Non-Responders (N=30) | pa | Odds Ratio | 95% CI |
|---|---|---|---|---|---|---|
| 0.008 | 3.3 | 1.35–8.09 | ||||
| rs41423247 | CC | 24 (34.3%) | 19 (63.3%) | |||
| CG | 39 (55.7%) | 9 (30.0%) | ||||
| GG | 7 (10.0%) | 2 (6.7%) | ||||
| Alleles | 0.032 | 2.2 | 1.09–4.44 | |||
| C | 87 (62.1%) | 47 (78.3%) | ||||
| G | 53 (37.9%) | 13 (21.7%) | ||||
| rs6195 | 0.213 | 0.2 | 0.01–2.32 | |||
| AA | 69 (98.5%) | 28 (93.3%) | ||||
| TT | 1 (1.5%) | 2 (6.7%) | ||||
| Alleles | 0.067 | 0.2 | 0.036–1.14 | |||
| A | 138 (98.5%) | 56 (93.3%) | ||||
| T | 2 (1.5%) | 4 (0.7%) | ||||
| rs6189/rs6190 | 0.999 | 1.7 | 0.19–16.41 | |||
| AA | 66 (94.3%) | 29 (96.7%) | ||||
| TT | 4 (5.7%) | 1 (3.3%) | ||||
| Alleles | 0.999 | 0.8 | 0.24–2.93 | |||
| A | 132 (94.2%) | 56 (96.6%) | ||||
| T | 8 (5.8%) | 4 (0.4%) | ||||
a
Chi-square t test p value.
| Analysis | Log-Additive (CC=0, CG=1, GG=2) | Recessive (CC and CG versus GG) | Dominant (CG and GG versus CC) |
|---|---|---|---|
| p value | 0.016 | 0.58 | 0.007 |
| Odds ratio | 2.41 | 1.56 | 3.31 |
| 95% CI | 1.13–5.14 | 0.30–7.97 | 1.36–8.07 |
There was no significant association between different genotypes and alleles of rs6195 and rs6189/rs6190 variants and response to fluoxetine (p=0.213 and 0.99, respectively).
Discussion
To our knowledge, this is the first study investigating the relationship between GCR genetic polymorphisms and response to fluoxetine in depressed Iranian patients. Here, we found that MDD patients who carry the G allele of rs41423247 respond approximately two times better than the carriers of the C allele (p=0.032, OR=2.2, 95% CI=1.09–4.44) and that carriers of CG and GG genotypes respond three times more to fluoxetine compared with CC carriers (p=0.008, OR=3.3, 95% CI=1.35–8.07).
According to a report by Van Rossum et al., the GG and CG genotypes were functionally equivalent because cortisol levels were significantly lower in the carriers of the two genotypes (G-allele carriers) than CC carriers after dexamethasone suppression tests.38 Our results support this conclusion, showing the equivalence of the therapeutic response behavior of the G-allele carriers. Furthermore, the associated increased sensitivity to GCs in carriers of the G allele can explain the observed increased responsiveness to fluoxetine.38 The high expression of GCRs in hippocampal formation underlies the atrophic response to stress hormones in these regions of the brain.39 Being therefore at increased risk of depression secondary to these structural changes, carriers of the G allele of rs41423247 are more responsive to antidepressants like fluoxetine, because stress hormone levels are readily decreased in response to medication.39,40
With the increasing rate of depression worldwide,2 response and remission rates are quite unsatisfactory.41 While many studies highlight the contribution of genetics in susceptibility to this illness,42,43 the role of genetics as a therapeutic determinant still remains elusive. Along with the association studies focusing on the monoaminergic hypothesis of MDD,44–47 newer candidate genes affecting the HPA axis have gained attention as well.17,48,49 There is some evidence of the involvement of HPA axis in MDD,50,51 and previous findings suggest the interrelation between HPA axis and GC signaling as a pathophysiologic determinant of MDD development and progression.25,50,52
Antidepressants stimulate GCR function and expression in depressed patients and animal models.33 In vivo and in vitro studies suggest that GCR gene expression and, at the same time, sensitivity to glucocorticoid activation are increased by means of antidepressants.25,33,52 They induce GCR nuclear translocation and transactivation mediated by the cAMP/PKA cascade26,29,33 and control neurogenesis in hippocampus by GCR-dependent mechanisms requiring PKA signaling. This is accompanied by alterations in GCR phosphorylation and GCR-dependent gene transcription, which eventually result in enhanced neurogenesis. The effect that antidepressants exert on GCR signaling eventuates in a negative feedback on the HPA axis activity as well and, overall, suggests the diverse mechanisms of action for medications used in MDD.26
Regarding the study polymorphism, rs41423247 has been shown to be associated with several psychiatric abnormalities. In a study conducted in Polish adolescent girls, rs41423247 was associated with higher incidence of anorexia nervosa,53 a condition in which almost 80% of the patients suffer from MDD as well.54 Role of stressful life events on PTSD by means of GCR gene polymorphisms has been reported by Lian et al.22 A study in overweight children also advocates for the role of this variant in developing emotional dysregulation.21 Contrary to these findings, lack of association between this variant and perinatal depression was observed in a group of Chinese descent.55 Another report examined the impact of physical activity with MDD and suicidal ideation with respect to rs41423247 and found that this polymorphism does not influence these two outcomes.56
Genetic components of GCRs as therapeutic determinants therefore emerged from both the pathophysiological involvement of GCRs in MDD and the effects of antidepressants on GCR-related pathways. This can even translate into the personalized response to certain medications and explain some of the variabilities associated with fluoxetine response rates among MDD patients. Since the proposition of the involvement of GCR-related pathways in the overall function of the antidepressants, there have only been a few studies reporting the association of rs41423247 polymorphism and response to antidepressants. Consistent with our findings regarding the association of rs41423247 polymorphism with response to fluoxetine, Takahashi et al. has reported the same result in a Japanese population.57 On the other hand, van Rossum et al., despite describing a significant association between variants of rs41423247 and MDD, has reported lack of association between variants of this polymorphism and antidepressant treatment.18 In the mentioned study, however, different classes of antidepressants were used, and differential analysis regarding each class with respect to rs41423247 was not performed. Ventura-Junca et al. also reported lack of association between rs41423247 variant and fluoxetine treatment.58 Brouwer et al., in contrast with our findings, reported that carriers of the G allele, especially male patients, seem to be more resistant to therapy.59
Regarding rs6189/rs6190 and rs6195 polymorphisms, our results showed lack of association with response to treatment, which is consistent with a previous report in a Dutch population.59 However, in a German population, rs6189/rs6190 polymorphism was associated with a faster response to antidepressant treatment.18 The rs41423247 and rs6195 polymorphisms have been shown to be related to hypersensitivity to glucocorticoids,38 while the rs6189/rs6190variant is associated with glucocorticoid resistance.60 It seems that both glucocorticoid resistance and increase in GCR effects in parts of the brain contribute to response to antidepressant treatment.
It is noteworthy that we only recruited patients labeled as newly diagnosed with MDD, which refers to the absence of any concomitant psychiatric disorders and parallel medication use in them. Therefore, the observed results, although not obtained from a clinical trial design, would reflect a more probable cause-and-effect relationship. This is especially important in weighing the evidence in observational studies like ours and can corroborate the relation of a better response rate to fluoxetine with carrying the G allele of GCR gene, in that the other confounders are kept at a minimal level. We believe a randomized allocation of fluoxetine versus placebo in G and C allele carriers is a mandatory next step to justify our results. Besides, regarding conflicting reports suggesting diverse responses to therapy in G allele carriers in different populations, more studies ought to be done to reproduce the results and make the underlying association clearer.
Conclusions
Our data reveal that rs41423247 polymorphism is associated with response to fluoxetine. This further supports the hypothesis of involvement of GCR in response to treatment in depression, in which it is an influential element on the HPA-axis regulation.
References
1.
Ferrari AJ, Charlson FJ, Norman RE, et al: Burden of depressive disorders by country, sex, age, and year: findings from the global burden of disease study 2010. PLoS Med 2013; 10:e1001547
2.
Marcus M, Yasamy MT, van Ommeren M, et al: Depression: A global public health concern. Geneva, Switzerland, World Health Organization Department of Mental Health and Substance Abuse, 2012
3.
Badamgarav E, Weingarten SR, Henning JM, et al: Effectiveness of disease management programs in depression: a systematic review. Am J Psychiatry 2003; 160:2080–2090
4.
Cizza G, Ronsaville DS, Kleitz H, et al: Clinical subtypes of depression are associated with specific metabolic parameters and circadian endocrine profiles in women: the power study. PLoS One 2012; 7:e28912
5.
Yamada N, Katsuura G, Ochi Y, et al: Impaired CNS leptin action is implicated in depression associated with obesity. Endocrinology 2011; 152:2634–2643
6.
Steiger A, Dresler M, Kluge M, et al: Pathology of sleep, hormones and depression. Pharmacopsychiatry 2013; 46(S 01):S30–S50
7.
Malhi GS, Moore J, McGuffin P: The genetics of major depressive disorder. Curr Psychiatry Rep 2000; 2:165–169
8.
Holsboer F, Barden N: Antidepressants and hypothalamic-pituitary-adrenocortical regulation. Endocr Rev 1996; 17:187–205
9.
Stetler C, Miller GE: Depression and hypothalamic-pituitary-adrenal activation: a quantitative summary of four decades of research. Psychosom Med 2011; 73:114–126
10.
Solomon MB, Furay AR, Jones K, et al: Deletion of forebrain glucocorticoid receptors impairs neuroendocrine stress responses and induces depression-like behavior in males but not females. Neuroscience 2012; 203:135–143
11.
Jeanneteau FD, Lambert WM, Ismaili N, et al: BDNF and glucocorticoids regulate corticotrophin-releasing hormone (CRH) homeostasis in the hypothalamus. Proc Natl Acad Sci USA 2012; 109:1305–1310
12.
Von Werne Baes C, de Carvalho Tofoli SM, Martins CMS, et al: Assessment of the hypothalamic-pituitary-adrenal axis activity: glucocorticoid receptor and mineralocorticoid receptor function in depression with early life stress—a systematic review. Acta Neuropsychiatr 2012; 24:4–15
13.
Slof-Op’t Landt MC, DeRijk RH, van Son GE, et al: A common mineralocorticoid receptor polymorphism (I180V) interacts with life events in relation to perfectionism in eating disorders: a pilot study. Eur Eat Disord Rev 2014; 22:423–429
14.
Martins CS, Elias D, Colli LM, et al: HPA axis dysregulation, NR3C1 polymorphisms and glucocorticoid receptor isoforms imbalance in metabolic syndrome. Diabetes Metab Res Rev (Epub ahead of print, Oct 24, 2016)
15.
Panek M, Jonakowski M, Zioło J, et al: A novel approach to understanding the role of polymorphic forms of the NR3C1 and TGF-β1 genes in the modulation of the expression of IL-5 and IL-15 mRNA in asthmatic inflammation. Mol Med Rep 2016; 13:4879–4887
16.
Herman JP, Ostrander MM, Mueller NK, et al: Limbic system mechanisms of stress regulation: hypothalamo-pituitary-adrenocortical axis. Prog Neuropsychopharmacol Biol Psychiatry 2005; 29:1201–1213
17.
Szczepankiewicz A, Leszczyńska-Rodziewicz A, Pawlak J, et al: FKBP5 polymorphism is associated with major depression but not with bipolar disorder. J Affect Disord 2014; 164:33–37
18.
van Rossum EF, Binder EB, Majer M, et al: Polymorphisms of the glucocorticoid receptor gene and major depression. Biol Psychiatry 2006; 59:681–688
19.
van West D, Van Den Eede F, Del-Favero J, et al: Glucocorticoid receptor gene-based SNP analysis in patients with recurrent major depression. Neuropsychopharmacology 2006; 31:620–627
20.
Won E, Kang J, Kim A, et al: Influence of BclI C/G (rs41423247) on hippocampal shape and white matter integrity of the parahippocampal cingulum in major depressive disorder. Psychoneuroendocrinology 2016; 72:147–155
21.
Castellini G, Lelli L, Tedde A, et al: Analyses of the role of the glucocorticoid receptor gene polymorphism (rs41423247) as a potential moderator in the association between childhood overweight, psychopathology, and clinical outcomes in eating disorders patients: a 6 years follow up study. Psychiatry Res 2016; 243:156–160
22.
Lian Y, Xiao J, Wang Q, et al: The relationship between glucocorticoid receptor polymorphisms, stressful life events, social support, and post-traumatic stress disorder. BMC Psychiatry 2014; 14:232
23.
Park S, Hong JP, Lee J-K, et al: Associations between the neuron-specific glucocorticoid receptor (NR3C1) Bcl-1 polymorphisms and suicide in cancer patients within the first year of diagnosis. Behav Brain Funct 2016; 12:22
24.
Barden N: Regulation of corticosteroid receptor gene expression in depression and antidepressant action. J Psychiatry Neurosci 1999; 24:25–39
25.
Pariante CM, Miller AH: Glucocorticoid receptors in major depression: relevance to pathophysiology and treatment. Biol Psychiatry 2001; 49:391–404
26.
Anacker C, Zunszain PA, Cattaneo A, et al: Antidepressants increase human hippocampal neurogenesis by activating the glucocorticoid receptor. Mol Psychiatry 2011; 16:738–750
27.
Szymańska M, Budziszewska B, Jaworska-Feil L, et al: The effect of antidepressant drugs on the HPA axis activity, glucocorticoid receptor level and FKBP51 concentration in prenatally stressed rats. Psychoneuroendocrinology 2009; 34:822–832
28.
Anacker C, Zunszain PA, Carvalho LA, et al: The glucocorticoid receptor: pivot of depression and of antidepressant treatment? Psychoneuroendocrinology 2011; 36:415–425
29.
Miller AH, Vogt GJ, Pearce BD: The phosphodiesterase type 4 inhibitor, rolipram, enhances glucocorticoid receptor function. Neuropsychopharmacology 2002; 27:939–948
30.
Rush AJ, Trivedi MH, Wisniewski SR, et al: Bupropion-SR, sertraline, or venlafaxine-XR after failure of SSRIs for depression. N Engl J Med 2006; 354:1231–1242
31.
Beasley CM Jr, Nilsson ME, Koke SC, et al: Efficacy, adverse events, and treatment discontinuations in fluoxetine clinical studies of major depression: a meta-analysis of the 20-mg/day dose. J Clin Psychiatry 2000; 61:722–728
32.
Gibbons RD, Hur K, Brown CH, et al: Benefits from antidepressants: synthesis of 6-week patient-level outcomes from double-blind placebo-controlled randomized trials of fluoxetine and venlafaxine. Arch Gen Psychiatry 2012; 69:572–579
33.
Pariante CM, Kim RB, Makoff A, et al: Antidepressant fluoxetine enhances glucocorticoid receptor function in vitro by modulating membrane steroid transporters. Br J Pharmacol 2003; 139:1111–1118
34.
Serretti A, Artioli P, Quartesan R: Pharmacogenetics in the treatment of depression: pharmacodynamic studies. Pharmacogenet Genomics 2005; 15:61–67
35.
Diagnostic and Statistical Manual of Mental Disorders, 5th ed. Arlington, VA, American Psychiatric Publishing, 2013
36.
Miller SA, Dykes DD, Polesky HF: A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988; 16:1215
37.
González JR, Armengol L, Solé X, et al: SNPassoc: an R package to perform whole genome association studies. Bioinformatics 2007; 23:644–645
38.
van Rossum EF, Koper JW, van den Beld AW, et al: Identification of the BclI polymorphism in the glucocorticoid receptor gene: association with sensitivity to glucocorticoids in vivo and body mass index. Clin Endocrinol (Oxf) 2003; 59:585–592
39.
McEwen BS: Glucocorticoids, depression, and mood disorders: structural remodeling in the brain. Metabolism 2005; 54(Suppl 1):20–23
40.
Szczepankiewicz A, Leszczyńska-Rodziewicz A, Pawlak J, et al: Glucocorticoid receptor polymorphism is associated with major depression and predominance of depression in the course of bipolar disorder. J Affect Disord 2011; 134:138–144
41.
Machado M, Iskedjian M, Ruiz I, et al: Remission, dropouts, and adverse drug reaction rates in major depressive disorder: a meta-analysis of head-to-head trials. Curr Med Res Opin 2006; 22:1825–1837
42.
Baghai TC, Schule C, Zwanzger P, et al: Hypothalamic-pituitary-adrenocortical axis dysregulation in patients with major depression is influenced by the insertion/deletion polymorphism in the angiotensin I-converting enzyme gene. Neurosci Lett 2002; 328:299–303
43.
Flint J, Kendler KS: The genetics of major depression. Neuron 2014; 81:484–503
44.
Eley TC, Sugden K, Corsico A, et al: Gene-environment interaction analysis of serotonin system markers with adolescent depression. Mol Psychiatry 2004; 9:908–915
45.
Schulze TG, Müller DJ, Krauss H, et al: Association between a functional polymorphism in the monoamine oxidase A gene promoter and major depressive disorder. Am J Med Genet 2000; 96:801–803
46.
Vaht M, Kiive E, Veidebaum T, et al: A functional vesicular monoamine transporter 1 (VMAT1) gene variant is associated with affect and the prevalence of anxiety, affective and alcohol use disorders in a longitudinal population-representative birth cohort study. Int J Neuropsychopharmacol 2016; 19:pyw013
47.
D’Souza S, Thompson JM, Slykerman R, et al: Environmental and genetic determinants of childhood depression: The roles of DAT1 and the antenatal environment. J Affect Disord 2016; 197:151–158
48.
Ching-López A, Cervilla J, Rivera M, et al: Epidemiological support for genetic variability at hypothalamic-pituitary-adrenal axis and serotonergic system as risk factors for major depression. Neuropsychiatr Dis Treat 2015; 11:2743–2754
49.
Hardeveld F, Spijker J, Peyrot WJ, et al: Glucocorticoid and mineralocorticoid receptor polymorphisms and recurrence of major depressive disorder. Psychoneuroendocrinology 2015; 55:154–163
50.
Kumsta R, Moser D, Streit F, et al: Characterization of a glucocorticoid receptor gene (GR, NR3C1) promoter polymorphism reveals functionality and extends a haplotype with putative clinical relevance. Am J Med Genet B Neuropsychiatr Genet 2009; 150B:476–482
51.
Mello AF, Juruena MF, Pariante CM, et al: Depressão e estresse: existe um endofenótipo? [Depression and stress: is there an endophenotype?]. Rev Bras Psiquiatr 2007; 29(Suppl 1):S13–S18
52.
Pariante CM, Thomas SA, Lovestone S, et al: Do antidepressants regulate how cortisol affects the brain? Psychoneuroendocrinology 2004; 29:423–447
53.
Dmitrzak-Weglarz M, Szczepankiewicz A, Slopien A, et al: Association of the glucocorticoid receptor gene polymorphisms and their interaction with stressful life events in Polish adolescent girls with anorexia nervosa. Psychiatria Danubina 2016; 28(1):51–57
54.
Lee S, Chan YY, Hsu LK: The intermediate-term outcome of Chinese patients with anorexia nervosa in Hong Kong. Am J Psychiatry 2003; 160:967–972
55.
Tan E-C, Chua T-E, Lee TM, et al: Case-control study of glucocorticoid receptor and corticotrophin-releasing hormone receptor gene variants and risk of perinatal depression. BMC Pregnancy Childbirth 2015; 15:283
56.
Taylor MK, Beckerley SE, Henniger NE, et al: A genetic risk factor for major depression and suicidal ideation is mitigated by physical activity. Psychiatry Res 2017; 249:304–306
57.
Takahashi H, Yoshida K, Higuchi H, et al: Bcl1 polymorphism of the glucocorticoid receptor gene and treatment response to milnacipran and fluvoxamine in Japanese patients with depression. Neuropsychobiology 2014; 70:173–180
58.
Ventura-Juncá R, Symon A, López P, et al: Relationship of cortisol levels and genetic polymorphisms to antidepressant response to placebo and fluoxetine in patients with major depressive disorder: a prospective study. BMC Psychiatry 2014; 14:220
59.
Brouwer JP, Appelhof BC, van Rossum EF, et al: Prediction of treatment response by HPA-axis and glucocorticoid receptor polymorphisms in major depression. Psychoneuroendocrinology 2006; 31:1154–1163
60.
van Rossum EF, Koper JW, Huizenga NA, et al: A polymorphism in the glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels. Diabetes 2002; 51:3128–3134
61.
Bachmann AW, Sedgley TL, Jackson RV, et al: Glucocorticoid receptor polymorphisms and post-traumatic stress disorder. Psychoneuroendocrinology 2005; 30:297–306
62.
Huizenga NA, Koper JW, De Lange P, et al: A polymorphism in the glucocorticoid receptor gene may be associated with and increased sensitivity to glucocorticoids in vivo. J Clin Endocrinol Metab 1998; 83:144–151
63.
Panek M, Pietras T, Szemraj J, et al: Association analysis of the glucocorticoid receptor gene (NR3C1) haplotypes (ER22/23EK, N363S, BclI) with mood and anxiety disorders in patients with asthma. Exp Ther Med 2014; 8:662–670
Information & Authors
Information
Published In
History
Received: 12 December 2016
Revision received: 20 March 2017
Accepted: 24 March 2017
Published online: 23 June 2017
Published in print: Winter 2018
Keywords
Authors
Competing Interests
The authors report no financial relationships with commercial interests.
Funding Information
Shiraz University of Medical Sciences10.13039/501100004320: 94-01-36-10594
Metrics & Citations
Metrics
Citations
Export Citations
If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download.
For more information or tips please see 'Downloading to a citation manager' in the Help menu.
View Options
View options
PDF/EPUB
View PDF/EPUBLogin options
Already a subscriber? Access your subscription through your login credentials or your institution for full access to this article.
Personal login Institutional Login Open Athens loginNot a subscriber?
PsychiatryOnline subscription options offer access to the DSM-5-TR® library, books, journals, CME, and patient resources. This all-in-one virtual library provides psychiatrists and mental health professionals with key resources for diagnosis, treatment, research, and professional development.
Need more help? PsychiatryOnline Customer Service may be reached by emailing [email protected] or by calling 800-368-5777 (in the U.S.) or 703-907-7322 (outside the U.S.).